Introduction
Gastrointestinal nematode
disease of livestocks is parasitic disease seriously threatening the
development of livestock industry and annually causing huge economic losses
(Sréter et al. 1994; Tembely et al. 1997; Kaewthamasorn
and Wongsamee 2006; Terrill et al. 2012). Currently,
the disease is mainly prevented and controlled by chemical drugs. However,
long-term use of these chemical drugs at high dosage has drawbacks (drug
resistance, drug residues and environmental pollution) and becomes an
increasingly prominent issue (Hay et al.
1997; Alvarez et al. 2008). Therefore, it is necessary to seek animal-
and environment-friendly prevention and control methods. Using nematode
predators-nematode-trapping fungi (NTF) to achieve the goal is
considered as a prospective biological method (Grønvold et al. 1993; Gives and Vazquez-Prats 1994; Bird and
Herd 1995; Chandrawathani et al.
1998; Fernández et al. 1999;
Flores-Crespo et al. 2003).
NTF, are class fungi of more than 700 species
that are able to prey, parasite or colonize nematodes. As the natural nematode
predators, NTF can produce predatory organs to capture nematodes, most of their
preying processes include identification, attraction, adhesion and degradation
(Nordbring-Hertz et al. 2006), among
which, adhesion is the most important step for preying nematodes. However, so
far, the underlying molecular mechanisms of NTF preying nematodes are still
incompletely understood (Liang et al. 2013; Andersson et al. 2014; Liu et al. 2014).
In recent years, the genomes of a number of NTF
have been successfully sequenced and their genes related to predation have been
studied in depth (Liu et al. 2018; Liang et al. 2013). As a representative
of predatory fungi of nematode species, the genome of Arthrobotrys oligospora
was first sequenced in 2011. Based on the results, Yang et al.
(2011) predicated 17 adhesion-related protein-coding genes and found by qPCR
that one of the predicted proteins, named ADP1,
was upregulated by 21.7-fold during their predatory organ formation, suggesting
that ADP1 may play an important role
in the process of A. oligospora trapping nematode (Yang et al. 2011). However, the molecular
characteristics and function of ADP1
of A. oligospora is still
uncovered. The aim of this study is to analyze the molecular characteristic of a novel ADP1 protein of A. oligospora, and to explore the roles of ADP1 protein in the process of
nematode-trapping, thus understanding the biological function of ADP1 of A. oligospora in invading
nematodes.
Materials and Methods
Amplification
of ADP1 gene of A. oligospora
Based on the full-length A. oligospora ADP1 gene sequence with accession number AOL_s00210g23 in GenBank
published by Yang et al. (2011), a pair of ADP1 specific primer P1 and
P2 was designed. After cultured in liquid LMZ medium (Tiangen, China) at 26°C
with shaking at 150 rpm for 3 d, A. oligospora XJ-A1 strain was collected and its total RNA was
extracted using Trizol (Invitrogen, USA) and reversely transcripted into cDNA
using PrimeScriptTM reagent kit (Takara, Japan). The cDNA was then
used as the template to amplify ADP1
gene at PCR reaction conditions of 95°C for 5 min followed by 30 cycles of 40 s
at 94°C, 40s at 64°C and 1 min at 72 and final 10 min at 72°C.
Cloning of ADP1 gene from A. oligospora
The obtained ADP1 gene was
recovered using Agarose Gel DNA Fragment Recovery Kit (Takara, Japan) and
cloned into pMD18-T vector (Takara, Japan). The correct clones were identified
by PCR and digestion with EcoRI and BamHI and further verified by sequencing
(BGI, Shenzhen). Four positive clones were sequenced and compared with A.
oligospora ADP1 gene sequence in
GenBank.
Analysis of molecular characteristics of ADP1
protein of A. oligospora
The amino acid sequence of ADP1
was deduced, and its signal peptide was analyzed by software SignalP 4.1
(https://www.cbs.dtu.dk/services/SignalP/). The transmembrane and domains of this protein were predicted by TMHMM
2.0 and Scanprosite software (https://www.expasr.org/),
respectively. Moreover, the secondary and tertiary structures were also
predicted by Software Sopma and Swiss-model (https://www.expasr.org/),
respectively.
Expression
and purification of recombinant protein ADP1-GFP
The obtained plasmid pT-ADP1 and the expression vector pET28a-GFP were
digested with restriction enzymes EcoRI
and Hind III, respectively, and the
digested vector and targeted ADP1
fragment were ligated at 16°C to generate pET28a-GFP-ADP1 recombinant
expression vector. The pET28a-GFP-ADP1 and pET28a-GFP plasmids were identified
by PCR using specific primers P1-P2 and P1-P4, respectively, and then
transformed into E. coli BL21 (DE3) for expression. After 6 h of IPTG
(Takara, Japan) induction, cell lysates were subjected to 12% SDS-PAGE
analysis. Then, Western blot analysis was performed by using the mouse anti-reADP1 antibody as the primary antibody
and HRP-labeled goat anti-mouse antibody (Abcam, USA) as the secondary
antibody. The expressed recombinant proteins reADP1-GFP and reGFP were
purified using Ni-NTA Spin Kit (Qiagen, Germany) according to the instructions
provided by the manufacturer, concentrated with millipore ultrafiltration
system (Amicon, USA) and adjusted to 1 mg/mL 0.01 M
PBS, pH 7.2 solution for future use.
Analysis of
interactions between reADP1-GFP and
nematode
Briefly, the infective larva of Caenorhabditis elegans and Haemonchus contortus were prepared as
suspensions of 2000 nematodes per mL. Then, 1 mL of the larval suspension of C.
elegans and H. contortus were incubated with 1 mL of reADP1-GFP,
GFP, bovine serum albumin (BSA) and
trypsin-treated reADP1-GFP at 25°C
for 1 h, respectively. Then, 200 μL of each mixture was taken out
and centrifuged at 6000 rpm for 1 min and the collected nematodes were washed
with 0.01 M PBS, pH 7.2 for 6 times to be observed under a fluorescent
microscope.
Effects of
anti-ADP1 antibody on the
nematode-trapping activity of A.
oligospora
The hyphae were transferred to corn meal agar (CMA) solid medium (17 g
corn meal, 10 g agar and 2 g K2 HPO4 in 1 L of water,
adjusted to pH 7 using 1 M NaOH) containing 0.2% rabbit anti-A. oligospora serum, and cultured at
26°C in light-free condition. After 3 days of culture, larval suspension (100
strips) of H. contortus was added to
the plate. The traps and captured nematodes were counted under a light
microscope after 12, 24, 36 and 48 h, respectively. The numbers of traps and
captured nematodes were calculated according to the references (Zhao et al. 2014; Zhang et al. 2017).
Statistical analyses
Statistical
analyses were conducted using S.A.S. software Version 9.1 (S.A.S. Institute,
Inc., Cary, NC, USA). A
comparison of the number of captured nematode between
different groups was performed using the Chi-square test. The values of P < 0.05
were considered as statistically significant, while P < 0.01 as an extremely
significant difference.
Results
cDNA of ADP1 gene amplified from A.
oligospora by RT-PCR was about 500 bp (Fig. 1). The sequencing results
showed that the complete length of ADP1
gene was 468 bp, which encoded 155 amino acids (Fig. 2). The sequences of ADP1 gene from A. oligospora
XJ-A1 strain had been submitted to GenBank under accession numbers MT995855.
The ADP1 gene shared 96.37%
identities in nucleotide and 94.19% identities in amino acid, respectively,
when it was compared with the corresponding gene (AOL_s00210g23) of A.
oligospora deposited in GenBank. The ADP1
protein did contain signal peptide but
owned a transmembrane region at amino acids 93-115 of this protein. Analysis of SWISS-MODEL software revealed that ADP1 formed a cylindrical tertiary
structure (Fig. 3).
The recombinant GFP-ADP1 (reADP1-GFP) and recombinant GFP (reGFP) proteins expressed in
pET28a-GFP-ADP and pET28a-GFP transformed E. coli DE3 strain after 6 h
of induction with IPTG, showed the expected sizes of 50 kDa and 30 kDa,
respectively (Fig. 4 and 5) on SDS-PAGE. Western blot analysis showed that the
expressed 50 kDa recombinant protein could interact with rabbit anti-ADP1 serum, confirming the successful
expression of reADP1-GFP (Fig. 2 and
4). SDS-PAGE analysis showed that the reADP1-GFP
and reGFP purified with Ni-NTA
affinity column had very high purity (Table 1; Fig. 5).
The collected C. elegans and H.
contortus after incubation with purified reADP1-GFP for 1 h at 25°C showed
green fluorescence on their surface, whereas those incubated with reGFP and BSA showed no green
fluorescence on their surface under a fluorescence microscope (Fig. 6),
confirming that only reADP1-GFP has
adhesion activity on nematode surface. In contrast, reADP1-GFP treated by trypsin lost its adhesion activity to the
surface of nematode when compared to reADP1-GFP
group, while PBS-treated reADP1-GFP
did not reduce its adhesion activity to nematode (Fig. 6).
A. oligospora treated by anti-reADP1-GFP serum in the experimental group could produce three
dimensional nets and capture nematodes as control group (Fig. 7A-D). Compared
with the control group, there was no significant differences in the
numbers of trap devices between experimental
and control group (P > 0.05)
(Fig. 7E). However, when treated by
anti-reADP1-GFP serum for 48 h, the
numbers of captured nematodes of A. oligospora
treated by anti-reADP1-GFP serum in the experimental group was significantly lower
than that in the control group (P
< 0.05) (Fig. 7F), which suggested
that the nematode-trapping activity of A.
oligospora could be inhibited by anti-ADP1
serum.
Discussion
Table 1: List of
primer sequences used in this study
|
Primer name |
Nucleotide sequence (5’→ 3’) |
Target gene |
Product size (bp) |
|
P1 |
CCGGAATTCATGTGTAAACCCTTCGAAATCG |
ADP1 |
468 |
|
P1 |
CCCAAGCTTTCATTTGACTTCATTAAGCTGCC |
||
|
P3 |
atgagtaaag gagaagaacttttcac |
GFP |
714 |
|
P4 |
TTTGTGTCCAAGAATGTTTCCATC |
Note: The underlined
sequences in P1 and P2 are the restriction sites of endonucleases EcoRI and Hind
III, respectively
%201249-1254_files/image002.png)
Fig. 1:
Amplification of ADP1 gene of Arthrobotrys oligospora by
RT-PCR
M: DNA marker (DL-2000), Lanes 1-3:
RT-PCR products of ADP1 gene
%201249-1254_files/image004.png)
Fig. 2:
Nucleotide sequence and amino acids of ADP1
protein
Note: The different amino acids
were underlined; the amino acids constituting transmembrane region
were shadowed
As a model of NTF, A. oligospora enters the parasitic stage by forming complex
three-dimensional networks to trap nematodes (Zhao et al. 2014). The trapping initiates a series of processes including adhesion,
penetration, and immobilization of nematodes (Tunlid et al. 1994; Ahman et al. 1996; Minglian et al.
2004; Nordbring-Hertz et al. 2006;
Yang et al. 2013; Liang et al. 2015;
Liu et al. 2020). Adhesion is a premise for NTF preying nematodes.
The research has shown that the adhesion process of NTF on C. elegans is a complex process requiring participation
of carbohydrates, proteins, as well as their complexes and other substances (Tunlid and Jansson 1992).
Nordbring-Hertz et al. (2006) found that there were
adhesion
%201249-1254_files/image006.png)
Fig. 3: Schematic diagram of molecular
characteristics of ADP1 protein of Arthrobotrys oligospora
A: Outside, transmembrane and
inside regions of ADP1 protein
B: Tertiary structure of ADP1 protein
Note: R1: Outside
region of membrane; R2: Transmembrane region; R3: Inside region of membrane
%201249-1254_files/image008.png)
Fig. 4: SDS-PAGE and western blot
analysis of the reADP1-GFP and reGFP
M: Standard protein marker (97.4, 66.2, 43.0,31.0, 20.1 kDa); Lanes 1 and 2: Cell lysates of pET28a-GFP-ADP1 transformed E. coli after induced with IPTG for 4 and
6 hours, respectively
Lanes 3 and 7: Cell lysates of pET28a transformed E.
coli after induced with IPTG for
4 and 6 hours, respectively; Lanes 4, 5 and 6: Cell lysates of pET28a-GFP transformed E. coli after induced with IPTG
%201249-1254_files/image010.png)
Fig. 5: SDS-PAGE and Western blot analysis
of the reADP1-GFP and reGFP
M: Standard protein marker (120.0, 85.0, 50.0, 35.0,
25.0, 20.0 kDa)
1: Purified reGFP protein
2: Purified reADP1-GFP protein
3: Western blot
analysis of reADP1-GFP protein
%201249-1254_files/image012.png)
Fig. 6: Analysis of interaction of reADP1-GFP
with nematodes
A: reADP1-GFP
interacts with C. elegans
B: reADP1-GFP
interacts with H. contortus
C: BSA interacts with H. contortus
D: Trypsin treated reADP1-GFP interacts with H. contortus
E: PBS treated reADP1-GFP
interacts with H. contortus
F: reADP1-GFP
interacts with H. contortus
%201249-1254_files/image014.png)
Fig. 7: Effects of anti-reADP1-GFP serum on the
nematode-trapping activity of A. oligospora
A-D: The trap devices in 12 h, 24 h, 36 h and 48 h post-induction of
larval suspension of H. contortus
E: The numbers of trap
devices; F: The numbers
of captured nematodes
substances between NTF and nematodes and confirmed that adhesion
substances contain lectin. Meerupati et al. (2013) revealed that certain
proteins also play important roles in the adhesion process. Yang et al. (2011) conducted whole genome
analysis of A. oligospora and predicted that 17 genes were related to
adhesion, among which, five genes were upregulated during the formation of
their predatory organs, suggesting that some proteins may play important roles
in the process of A. oligospora adhering to nematode (Yang et al. 2011). However, to date, the
active adhesion substances produced by NTF and their underlying molecular
mechanisms for adhesion are still incompletely understood (Meerupati et al. 2013; Liang et al. 2013).
Based on the studies on genomics and proteomics of A.
oligospora, many new functional proteins have been identified and
characterized (Li et al. 2016, 2017; Liang et al. 2017; Xie et al. 2019; Yang et al.
2018 Zhang et al. 2019). To better
understand the biological functions of ADP1, interactions between A. oligospora
ADP1 and nematode were conducted. The
results revealed that the reADP1-GFP
protein could adhere to the surface of nematode and was unable to be washed
away by elution buffer, suggesting that ADP1
has adhesion function to nematodes. Furthermore, we confirmed that ADP1 displayed stronger adhesion at
25°C, which is in consistence with the natural environment of fungi, suggesting
production of ADP1 may be an
environmental adaptability of fungi in the evolutionary process to form a
favorable environment for its predation under natural conditions. In addition,
trypsin digestion could block the adhesion ability of reADP1-GFP protein to nematode, while PBS did not affect its
adhesion activity to the surface of nematode, which suggests that this novel
protein ADP1 is involved in an adhesion role. The nematode-trapping activity of
A. oligospora inhibited by anti-ADP1-GFP serum further confirmed that
the ADP1 protein was closely related
to nematode-trapping process.
Conclusion
A. oligospora
ADP1 exerts an important role in the
process of fungal adherence to nematodes, which provides new insights into our
understanding of the molecular mechanisms of NTF preying nematodes.
Acknowledgments
This work was supported by National Natural Science
Foundation of China (32060801 and 31460654) and National Key Research and
Development Program (No. 2017YFD0501200). The authors thank the staff for
providing the materials for this study.
This work was supported by National Natural Science
Foundation of China (32060801, 31460654), National Key Research and Development
Program (No. 2017YFD0501200).
Author Contributions
Li Jie and Meng Qingling planned and designed the whole
study. Chen Shuangqing, Li zhiyuan, Wang Lixia, Shang Yunxia, Gong Shasha, Xiao
Chencheng, Zhang Kai performed and completed the experiments. Li Jie, Qiao Jun
and Meng Qingling wrote the manuscript. Zhang Xingxing and Cai Xuepeng reviewed
and revised the manuscript. All authors read and approved the final manuscript.
Conflict of Interest
This manuscript has not been simultaneously submitted for
publication in another journal and been approved by all co-authors. The authors
declare that they do not have any conflict of interest.
Data Availability
Data presented in this
study are available on fair request to the corresponding author.
Ethics Approval
The experiments were carried out in accordance with the
guidelines issued by the Ethical Committee of Shihezi University.
References
Ahman J, B Ek, L Rask, A
Tunlid (1996). Sequence analysis and regulation of a gene encoding a
cuticle-degrading serine protease from the nematophagous fungus Arthrobotrys oligospora. Microbiology 142:1605‒1616
Alvarez L, A Lifschitz, C Entrocasso,
J Manazza, L Mottier, B Borda, G Virkel, C Lanusse (2008). Evaluation of the
interaction between ivermectin and albendazole following their combined use in
lambs. J Vet Pharmacol Ther 31:230‒239
Andersson KM, D Kumar, J
Bentzer, E Friman, D Ahrén, A Tunlid (2014). Interspecific and host-related
gene expression patterns in nematode-trapping fungi. BMC Genom 15:968-982
Bird J, RP Herd (1995). In vitro assessment of two species of
nematophagous fungi (Arthrobotrys oligospora
and Arthrobotrys flagrans) to control
the development of infective cyathostome larvae from naturally infected horses.
Vet Parasitol 56:181‒187
Chandrawathani P, J Omar, PJ
Waller (1998). The control of the free-living stages of Strongyloides papillosus by the nematophagous fungus, Arthrobotrys oligospora. Vet Parasitol 76:321‒335
Fernández AS, E Henningsen, M Larsen, P Nansen, J Grønvold, J Søndergaard
(1999). A new isolate of the nematophagous fungus Duddingtonia flagrans a biological control agent against
free-living larvae of horse strongyles. Equine
Vet J 31:488‒491
Flores-Crespo J, D
Herrera-Rodríguez, PMD Gives, E Liébano-Hernández, VM
Vázquez-Prats, ME López-Arellano (2003). The predatory capability of three
nematophagous fungi in the control of Haemonchus
contortus infective larvae in ovine faeces. J Helminthol 77:297‒303
Gives PMD, VM Vazquez-Prats (1994).
Reduction of Haemonchus contortus
infective larvae by three nematophagous fungi in sheep faecal cultures. Vet Parasitol 55:197‒203
Grønvold J, J Wolstrup, M Larsen, SA Henriksen, P Nansen (1993). Biological
control of Ostertagia ostertagi by
feeding selected nematode-trapping fungi to calves. J Helminthol 67:31‒36
Hay FS, JH
Niezen, C Miller, L Bateson, H Robertson (1997). Infestation of sheep dung by nematophagous fungi and
implications for the control of free-living stages of gastro-intestinal
nematodes. Vet Parasitol 70:247‒254
Kaewthamasorn M, S Wongsamee (2006).
A preliminary survey of gastrointestinal and haemoparasites of beef cattle in
the tropical livestock farming system in Nan Province, northern Thailand. Parasitol Res 99:306‒308
Li J, Y Liu, H Zhu, KQ Zhang
(2016). Phylogenic analysis of adhesion related genes Mad1 revealed a positive
selection for the evolution of trapping devices of nematode-trapping fungi. Sci Rep 6; Article 22609
Li X, YQ Kang, YL Luo, KQ
Zhang, CG Zou, LM Liang (2017). The NADPH oxidase AoNoxA in Arthrobotrys oligospora functions as an
initial factor in the infection of Caenorhabditis
elegans. J Microbiol 55:885‒891
Liang L, H Gao, J Li, L Liu,
Z Liu, KQ Zhang (2017). The Woronin body in the nematophagous fungus Arthrobotrys oligospora is essential for
trap formation and efficient pathogenesis. Fung
Biol 121:11‒20
Liang L, R Shen, Y Mo, J
Yang, X Ji, KQ Zhang (2015). A proposed adhesin AoMad1 helps nematode-trapping
fungus Arthrobotrys oligospora
recognizing host signals for life-style switching. Fung Genet Biol 81:172‒181
Liang L, H Wu, Z Liu, R
Shen, H Gao, J Yang, K Zhang (2013). Proteomic and transcriptional analyses of Arthrobotrys oligospora cell wall
related proteins reveal complexity of fungal virulence against nematodes. Appl Microbiol Biotechnol
97:8683‒8692
Liu K, W Zhang,
Y Lai, M Xiang, X Wang, X Zhang, X Liu (2014). Drechslerella stenobrocha genome illustrates the mechanism of
constricting rings and the origin of nematode predation in fungi. BMC Genom 15; Article 114
Liu M, X Cheng, J Wang, D
Tian, K Tang, T Xu, M Zhang, Y Wang, M Wang (2020). Structural insights into
the fungi-nematodes interaction mediated by fucose-specific lectin AofleA from Arthrobotrys oligospora. Intl J Biol Macromol 164:783‒793
Liu T, DW Tian,
LJ Zou, FY Liu, QY Can, JK Yang, JP Xu, XW Huang , JQ Xi, ML Zhu, MH Mo, KQ
Zhang (2018). Quantitative proteomics revealed partial fungistatic mechanism of
ammonia against conidial germination of nematode-trapping fungus Arthrobotrys oligospora ATCC24927. Intl J Biochem Cell Biol 98:104‒112
Meerupati T, KM Andersson,
E Friman, D Kumar, A Tunlid, D Ahrén (2013). Genomic mechanisms accounting for
the adaptation to parasitism in nematode-trapping fungi. PLoS Genet 9; Article e1003909
Minglian Z, M Minghe, Z Keqin
(2004). Characterization of a neutral serine protease and its full-length cDNA
from the nematode-trapping fungus Arthrobotrys
oligospora. Mycologia 96:16‒22
Nordbring-Hertz B, HB Jansson, A Tunlid (2006). Nematophagous fungi. In Encyclopedia of Life Sciences. John Wiley
& Sons Ltd., New York, USA
Sréter T, V Molnár, T Kassai (1994). The distribution of nematode egg
counts and larval counts in grazing sheep and their implications for parasite
control. Intl J Parasitol 24:103‒108
Tembely S, A Lahlou-kassi, JE Rege, S Sovani, ML Diedhiou, RL Baker
(1997). The epidemiology of nematode infections in sheep in a cool tropical
environment. Vet Parasitol 70:129‒141
Terrill TH, JE Miller, JM Burke, JA Mosjidis, RM Kaplan (2012). Experiences
with integrated concepts for the control of Haemonchus
contortus in sheep and goats in the United States. Vet Parasitol 186:28‒37
Tunlid A, HB Jansson (1992),
Nordbring-Hertz B. Fungal attachment to nematodes. Mycol Res 96:401‒412
Tunlid A, S Rosén, B Ek, L
Rask (1994). Purification and characterization of an extracellular serine
protease from the nematode-trapping fungus Arthrobotrys
oligospora. Microbiology 140:1687‒1695
Xie M, Y Wang, L Tang, L
Yang, D Zhou, Q Li, X Niu, KQ Zhang, J Yang (2019). AoStuA, an APSES
transcription factor, regulates the conidiation, trap formation, stress
resistance and pathogenicity of the nematode-trapping fungus Arthrobotrys oligospora. Environ Microbiol 21:4648‒4661
Yang J, Y Yan, L Juan, Z
Wei, G Zongyi, J Dewei, W Yunchuan, Z Ke-Qin (2013). Characterization and
functional analyses of the chitinase-encoding genes in the nematode-trapping
fungus Arthrobotrys oligospora. Arch Microbiol 195:453‒462
Yang J, L Wang, X Ji, Y
Feng, X Li, C Zou, J Xu, Y Ren, Q Mi, J Wu, S Liu, Y Liu, X Huang, H Wang, X
Niu, J Li, L Liang, Y Luo, K Ji, W Zhou, Z Yu, G Li, Y Liu, L Li, M Qiao, L
Feng, KQ Zhang (2011). Genomic and proteomic analyses of the fungus Arthrobotrys oligospora provide insights
into nematode-trap formation. PLoS Pathog 7; Article e1002179
Yang X, N Ma, L Yang, Y
Zheng, Z Zhen, Q Li, M Xie, J Li, KQ Zhang, J Yang (2018). Two Rab GTPases play
different roles in conidiation, trap formation, stress resistance, and
virulence in the nematode-trapping fungus Arthrobotrys
oligospora. Appl Microbiol Biotechnol
102:4601‒4613
Zhang D, X Zhu, F Sun, K
Zhang, S Niu, X Huang (2017). The roles of actin cytoskeleton and
actin-associated protein Crn1p in trap formation of Arthrobotrys oligospora. Res
Microbiol 168:655‒663
Zhang W, C Hu, M Hussain, J
Chen, M Xiang, X Liu (2019). Role of low-affinity calcium system member Fig1 homologous proteins in conidiation
and trap-formation of nematode-trapping fungus Arthrobotrys oligospora. Sci
Rep 9; Article 4440
Zhao X, Y
Wang, Y Zhao, Y Huang, KQ Zhang, J Yang (2014). Malate synthase gene AoMls in
the nematode-trapping fungus Arthrobotrys
oligospora contributes to conidiation, trap formation, and pathogenicity. Appl Microbiol Biotechnol 98:2555‒2563